In review (JACM)

Genomic profiling of neutrophil transcripts in Qigong practitioners:

A pilot study in gene regulation by mind/body interaction

University of Texas Southwestern Medical Center

Dallas, Texas 75390

Houston, Texas 77030

Address correspondence to Dr. Lili Feng, Baylor College of Medicine, Section of

Nephrology, One Baylor Plaza, Alkek N-520, Houston, TX 77030, USA.

Running title: Genomic profiling of gene expression by Qigong

Ubiquitin-dependent protein degradation pathway.

- 1 -

In review (JACM)

species stimulated us to search for genes regulated by mind/body interaction. DNA microarray

technology offers the advantage of analyzing thousands of genes simultaneously, with the

potential to determine healthy-phenotypic changes in gene expression. The aim of this study is

to determine the genomic profiling and function of neutrophils in Falun Gong (FLG, an ancient

Chinese Qigong) practitioners with healthy subjects as controls.

recruited for our study. Six practitioners have practiced FLG for at least one or more (1-5) years.

The practice includes daily reading of FLG book and daily practice of exercises of one to two

hours each time. Selected normal healthy controls did not perform Qigong, Yoga, Taiji, or any

other type of mind/body practice, and did not follow any conventional physical exercise program

for at least one year. Neutrophils were isolated from fresh blood of subjects and assayed for

gene expression using microarrays and by RNase protection, as well as for function

(phagocytosis) and survival (apoptosis).

healthy controls are characterized by enhanced immunity, downregulation of cellular

metabolism, and alteration of apoptotic genes in favor of a rapid resolution of inflammation. The

lifespan of normal neutrophils was prolonged, while the inflammatory neutrophils displayed

accelerated cell death in FLG practitioners as determined by ELISA. In correlating with

enhanced immunity reflected by microarray data, neutrophil phagocytosis was significantly

increased in Qigong practitioners. Some of the altered gene expression observed by microarray

were confirmed by RPA.

- 2 -

In review (JACM)

through transcriptional regulation. Our pilot study provides the first evidence that Qigong

practice may exert transcriptional regulation at a genomic level. It also suggests that a new

paradigm is urgently needed to study how genes are regulated at a genomic level by human

uniqueness-associated elements, such as consciousness, cognition, and spirituality.

- 3 -

In review (JACM)

There have been increasing interests in the phenomena of mind/body interaction, a

subject that had been considered hard to study due to its complex nature. However, there is

ample evidence to support the powerful physical effects of practices that are directed towards

mind or spirituality. While the health benefits of Yoga, meditation and prayer have been

documented and well recognized by the general public (Gimbel, 1998; Pettinati, 2001; Sovik,

2000; Cha et al. , 2001; Krucoff et al. , 2001), the mechanisms underlying such apparent

effects are not well understood at the physiological level, and in particular have not been

documented and systematically studied at the cellular or molecular level.

It was reported 25 years ago that the only differences that distinguish various species

might be the quantitative variation in gene expression rather than structural changes in gene

products (King and Wilson, 1975). The genomes of all mammals are so similar that it's hard to

understand how similar genetic materials can generate so many different living creatures (Paabo,

2001). Recently it was confirmed that mice and humans share more than 99% of their genetic

material, and one of the main differences between the mouse and human genome lies in the

activity of 'junk' DNA sequences that are coding for proteins (Waterston et al. , 2002; Dennis,

2002). What ¡§magic¡¨ factors could possibly be beyond the one-dimensional genome? If genes

of different animals are alike, then it is possible that other factors, such as mind-mediated

changes in gene regulation, might drive the differences between species. The difference in gene

activity of the brain between chimps and humans indicates that human uniqueness might be all in

the mind (Enard et al. , 2002). Genomic structure may provide the basic scaffolding; however,

the great differences between humans and other living creatures implies that there must be other

- 4 -

In review (JACM)

factors that control gene regulation and therefore may contribute greatly to the differences

among species. A great body of knowledge regarding gene regulation by a variety of physical

and pathological insults has been obtained; however, little has been done regarding how the mind

regulates gene expression, what mind-responsive genes are, and how mind-responsive genes

relate to and/or control the genes specifically regulated by physical and pathological stimuli. A

new paradigm is urgently needed to study how genes are regulated by human uniquenessassociated

factors, such as cognitive, psychological, and spiritual behavior.

A spiritual perspective in medical practice has been advocated with increasing urgency in

mainstream medical journals during the last few years (Emanuel et al. , 1998; Post et al. , 2000;

Chandler, 1999). In ancient Chinese connotations, the health is always tightly connected with

body, mind and spirit, as codified at some time in the first century BC (in a canonical text known

ways/practices at that time to help improve health by reinforcing body, mind, and spirit

simultaneously. Many of these practices we now call ¡§Qigong¡¨ (pronounced ¡§chi kung¡¨), which

are recognized today as some transitional health practices and healing techniques. Falun Gong

(FLG), also called Falun Dafa, is one type of those ancient Chinese Qigong practices, which

consists of exercise-meditation to energize the physical body, along with an emphasis on the

spiritual practice based on the triad of truthfulness, benevolence, and forbearance. It has been

reported that FLG exhibits very dramatic and powerful effects on practitioners (Dan et al. , 1998)

been thought to have a great impact on the human body, how the mind can specifically regulate

gene expression remains to be determined at both molecular and cellular levels.

- 5 -

In review (JACM)

DNA microarrays are powerful tools to monitor gene expression in both illness and

health. The advantages of microarray analyses include the ability to study the regulation of

several genes or even the entire genome in a single experiment. . In this study, we have

examined the genomic profiling as well as functional alteration of neutrophils from FLG

practitioners. Our studies indicate modern technology may be used as a scientific tool to study

the molecular mechanism of health benefits seen in people practicing spirituality or employing

alternative medicine.

Eligible subjects were 18 years of age or older. Six Asian FLG practitioners with three male and

three female (mean age = 46.7 years, SD = 13.3 years) and six Asian normal healthy controls

with three male and three female (mean age = 41.3 years, SD = 11.3 years) were recruited by

advertisement for our study. Six practitioners have practiced FLG for at least one or more (1¡V5)

years. The practice includes daily book reading (Li, 1994) and daily FLG exercise with one to

two hours each time. Selected normal healthy controls did not perform Qigong, Yoga, Taiji, any

type of mind/body practice, or physical exercise for at least one year. After obtaining informed

consent, 30 ml of heparinized blood was taken from subjects. The Institutional Review Board of

the Baylor College of Medicine approved the protocol.

Venous blood samples were collected into heparinized syringe and cells were separated

immediately. PMNs and mononuclear cells were prepared from heparinized blood by Ficoll-

- 6 -

In review (JACM)

Hypaque (Pharmacia Biotech, Uppsala, Sweden) density gradient centrifugation, followed by

dextran sedimentation. Contaminating erythrocytes were not removed to avoid further damage.

Neutrophils were subjected to further experiments without hypotonic treatment since it was

found that hypotonic treatment might damage neutrophils. Freshly isolated human neutrophils

were resuspended in PBS and enumerated by Coulter (Coulter Corporation, Miami, FL).

Microscopic examinations revealed that 96-98% of the cells were neutrophils and that more than

95% of the cells were viable by a trypan blue exclusion test.

Neutrophils were finally resuspended in RPMI 1640 with 10% FBS and adjusted to appropriate

concentration. The purity of PMNs isolated was always more than 98%, as determined by

Giemsa staining. PMN preparations consistently contained less than 1% monocytes. The PMN

viability was more than 98%, as estimated by trypan blue exclusion. For stimulation, neutrophils

were cultured in the presence of LPS (25 ng/ml, purchased from List Biological Laboratory,

Campbell, CA 95008). Neutrophils were cultured in the presence or absence of LPS at various

times as indicated.

The morphological changes of apoptosis were also demonstrated by light microscopic

examination of Wright-stained cytospins.

- 7 -

In review (JACM)

PMN cells were homogenized. Total RNA was extracted and purified with the Qiagen RNeasy

kit (Qiagen, San Diego, CA). Five micrograms of total RNA was used in the first-strand cDNA

synthesis with T7-d (T) 24 primer (GGCCAGTGAATTGTAATACGACTCACTATAGG

GAGGCGG- (DT) 24) and Superscript II (GIBCO-BRL, Rockville, MD). The second-strand

cDNA synthesis was carried out at 16¢XC by adding E. coli DNA ligase, E. coli DNA polymerase

I, and RNase H to the reaction, followed by T4 DNA polymerase to blunt the ends of newly

synthesized cDNA. The cDNA was purified through phase lock gels (PLG)-phenol/chloroform

extraction and ethanol precipitation. Using a BioArray High Yield RNA Transcript Labeling Kit

(Ensue Diagnostics, Inc, NY), the purified cDNA was incubated at 37¢XC for 6 h in an in vitro

transcription reaction to produce cRNA labeled with biotin.

cRNA was fragmented by incubating in a buffer containing 200 mM Tris-acetate (pH 8.1), 500

mM KOAc, and 150 mM MgOAc at 95°C for 35 min. The fragmented cRNA was hybridized

with a pre-equilibrated Affymetrix chip (Human Genome U95Av2) at 45°C for 14-16 h. After

the hybridization cocktails were removed, the chips were washed in a fluidic station with lowstringency

buffer (6 ?standard saline phosphate with EDTA, 0.01% Tween 20, and 0.005%

antifoam) for 10 cycles (two mixes/cycle) and a high stringency buffer (100 mM N-morpholinoethanesulfonic

acid (MES), 0.1 M NaCl, and 0.01% Tween 20) for four cycles (15 mixes/cycle)

and stained with SAPE (strepto-avidin phycoerythrin). This process was followed by incubation

with biotinylated mouse anti-avidin antibody and restaining with SAPE. The chips were scanned

in an HP ChipScanner (Affymetrix Inc, Santa Clara, CA) to detect hybridization signals.

- 8 -

In review (JACM)

Hybridization data from text files were imported to a Microsoft Excel spreadsheet. Data analysis

was performed to identify signals that were at least twofold different between FLG practitioner

and normal control samples.

RNase protection assay (RPA) was used to confirm the alteration of some genes in the subjects

as previously described using a manufacturer¡¦s protocol (Torrey Pines Biolabs, Houston, TX).

RPA was performed as described previously (Feng et al. , 1994; Xia et al. , 1999; Garcia et

al. , 2003). Total RNA was extracted from neutrophils using a single-step method (Chomczynski

assay. The probes are listed in the following: Ubiquitin (BM172182, bp 146-456); I-309

(M57502, bp 1- 250); Defensin (AW468629, bp 1-300), and H-APO-2c multi-probe set (Cat:

556235, BD Pharmingen, San Diego CA).

Cell death of neutrophils was assayed with a kit from Roche (Indianapolis, IN). In brief, 104

neutrophils in 200 ml of RPMI 1640 with 3% FBS were cultured in 96-well plates at 37¢XC and

harvested at different time points. After incubation, the cells were pelleted by centrifugation

and resuspended in lysis buffer. After lysis, intact nuclei were pelleted by centrifugation.

Nucleosome-containing supernatant was transferred to the streptavidin-coated plate and

incubated with anti-histone (biotin-labeled) and anti-DNA (peroxidase-conjugated) antibodies to

- 9 -

In review (JACM)

form an antibody-nucleosome complex. After washing the plate, samples were incubated with

peroxidase substrate (ABST) and the absorbance was measured at 405 nm.

The Human Genome U95 (HG-U95) Set, consisting of five GeneChipR arrays, contains almost

63,000 probe sets interrogating approximately 54,000 clusters derived from the UniGene

database. The HG-U95Av2 Array represents approximately 12,000 full-length genes. Among

12,000 genes examined, there are 250 genes that were consistently changed with 132 genes

downregulated and 118 genes upregulated in 6 FLG practitioners in contrast to 6 normal healthy

controls. Representative reproducibility of expression patterns is shown in Fig.1. In order to

measure the variation in gene expression between different preparations, separately prepared

samples (a and b) from one subject were used to hybridize the slides and signals were scanned

and recorded as described in materials and methods. As shown in Fig. 1, every spot is

rectangular in shape and has virtually the same size and similar signal intensities in separate

experiments, indicating reproducibility. Figure 2a shows a scatter plot of two different controls

(control 1 and 2) demonstrating a line of identity with very few genes showing different levels of

expression. Less than fifty genes showed a two fold or great difference in expression between

two normal controls. When a control was compared with a practitioner, significant numbers of

altered genes were seen in Fig 2b. Since the difference in controls was not significant, the

pooled RNA sample from six normal controls was used as a reference for an individual samples

from practitioners. The fold-changes between RNA of the each practitioner (n = 6) and the

- 10 -

In review (JACM)

Among the changed genes, the most interesting groups of genes are functionally

associated with protein degradation and synthesis (Fig. 3). The major mechanism used by

eukaryotic cells for disposing misfolded or damaged proteins present in the cell is an ubiquitindependent

protein degradation pathway (UPP) (Glickman and Ciechanover, 2002). The UPP

modification of many cellular proteins plays important roles in a variety of basic cellular

processes. The substrates of UPP include the genes responsible for regulation of the cell cycle,

division and of certain aspects of differentiation and development, modulation of the cellular

response to stress and extracellular effectors, morphogenesis of neuronal networks, downregulation

of cell surface receptors and ion channels, quality control in protein secretion, DNA

repair, regulation of the immune and inflammatory responses, and biogenesis of organelles.

Hundreds of cellular proteins are known to be targeted by UPP, and the list is growing steadily.

With the broad spectrum of protein substrates and complex machinery, it is not surprising that

the system has been recently implicated in the pathogenesis of many important diseases,

including genetic diseases, neuronal degenerative diseases, cancers, muscle wasting, diabetes,

hypertension, sepsis, autoimmune diseases, inflammation, and aging-related disorders. In most

conditions, the UPP-associated diseases result from hyper-metabolism. This system functions

like a molecular sensor and its?activity can be increased dramatically by many stressors; since

this system can always pull abnormal and damaged proteins in for degradation as a garbage

disposal.

The main components of the UPP are ubiquitin protein, ubiquitin-like proteins, and three major

enzymes: E1 (ubiquitin activating enzyme), E2 (ubiquitin conjugating enzyme), and E3

finger proteins are a group of proteins that have not been linked to a specific function until

- 11 -

In review (JACM)

recently (Joazeiro and Weissman, 2000). More and more studies implicate the RING finger

domain in specific ubiquitination events and it is possible that all RING finger proteins function

and/or act as E3 ubiqutin ligase (Freemont, 2000; Jackson et al. , 2000). We have found that in

the neutrophils isolated from FLG practitioners, a group of genes coding for ubiquitin, E2, and

E3 are dramatically downregulated. TRIM-containing RING protein (Reymond et al. , 2001),

which belongs to the RBCC family, is the only upregulated RING finger-containing protein

among all RING finger proteins we identified as depicted in Fig. 3. Strikingly, seven ubiquitin

E3 genes were downregulated simultaneously. In addition to the UPP system, an Ubiquitinindependent

protein degradation enzyme, ornithine decarboxylase antizyme (Coffino, 2001), was

decreased significantly. Downregulation of the UPP system may result from lowering of the

metabolic rate rather than the direct consequence of meditation. It was reported that Ubiquitin

was a heat-responsive and stress-induced gene (Bond and Schlesinger, 1985; Bond and

Schlesinger, 1986; Finch et al. , 1992; Nenoi, 1992; Sonneborn and Barbee, 1998),

therefore, downregulation of the Ubiquitin gene in meditation practitioners might result from

stress reduction. Nonetheless, there has been no literature to show that other components in the

UPP system are also stress-regulated genes.

Although cellular metabolism is significantly associated with protein turnover, the

economics of protein metabolism has long been neglected until the new concept of UPP

emerged. A great number of newly synthesized proteins are triaged immediately by being

delivered to UPP for degradation, perhaps due to the hyper-metabolic state in the cells. For

30% of the newly synthesized protein is immediately destroyed in the UPP (Yewdell, 2001).

During pathological conditions, the triaged proteins will be significantly increased and a great

- 12 -

In review (JACM)

array of human diseases can be linked to UPP (Hershko and Ciechanover, 1998; Vu and

Sakamoto, 2000; Ciechanover and Schwartz, 2002). Therapeutic inhibition of UPP has shown

some positive results in cancer patients (Adams, 2001; Garber, 2002).

Ribosomal proteins are very important components for protein synthesis and the decrease

of 10 of 11 genes for ribosomal proteins suggest that protein synthesis might be also lowered

(Fig. 3b). Ribosomes are the molecular machines that manufacture proteins (Maguire and

Zimmermann, 2001). Taking together, both decrease of genes for ribosomal proteins and protein

degradation indicate reduced protein turnover. In correlating with downregulation of protein

degradation and synthesis, the genes coding for proteins involved in DNA repair, cellular stress,

and anti-oxidant enzymes are also lowered (Fig. 3c). Decrease of those stress-associated key

enzymes, along with other stress-responsive genes; implicate limited oxidative production and

macromolecular damages. Those genes include RAD52 (for radiation resistance) and ERCCs

(for excision repair) mammalian homologues of yeast genes, are involved in DNA repair and

recombination. RAD52 and ERCC group genes are required for the repair of ionizing-radiationinduced

DNA damage induced by a variety of stressors (Symington, 2002; Tuteja and Tuteja,

2001). Reduction of cellular stress-associated genes may also suggest a hypometabolic

homeostasis at the cellular level. Unexpectedly, two heat shock proteins, HSP70 and HSP40-3,

are significantly increased in contrast to other downregulated stress-responsive genes (Fig. 3c).

The molecular mechanism for the reversed regulation of stress-regulated genes remains to be

further determined. It is interesting to investigate whether some of the stress-responsive genes

may be beneficially upregulated for protection (Latchman, 2001).

- 13 -

In review (JACM)

It has been documented that spiritual practice and mind/body approaches may enhance

the effectiveness of the immune system and further are clinically effective in treating a variety of

diseases (Coker, 1999; Shang, 2001; Jones, 2001). Psychological stress and negative

emotions can drastically intensify infection through immune dysregulation (Kiecolt-Glaser et al.

, 2002). It could be speculated that immunity ¡Vassociated genes may also be altered in

practitioners. As shown in Fig.3d, interferon (IFN)-gamma and IFN-related and IFN-regulated

sarcrolectin (Kaba et al. , 1999). Interestingly, an IFN-inducible gene, oligoadenylate synthetase,

was upregulated by about 3-fold (Samuel, 2001). Antimicrobial peptides are a prevalent group

of molecules in the host defense system. In mammals, defensins are among the most abundant of

these broad-spectrum antibiotics. The defensin peptides are especially abundant in neutrophils

(Kaiser and Diamond, 2000). Defensin 3, which was also increased in all of the practitioners

antimicrobial mechanisms (van Wetering et al. , 1999; Fellermann and Stange,

integrity of the bacterial cell membrane (please see the footnote). I-309 is also significantly

increased in practitioners as shown in Figure 3. I-309 is a chemotactic cytokine with its receptor

as an HIV co-factor (Horuk et al. , 1998; Lee et al. , 2000), and I-309 may function as an HIV

antagonist. The significant upregulation of I-309 among all practitioners examined indicates that

practitioners might have also gained increased HIV resistance (unpublished observation—do you

also an important cytokine in the host’s defense against infection by viral and microbial

- 14 -

In review (JACM)

contribute to immunity (Shtrichman and Samuel, 2001). Studies of transgenic mutant mice

immunity (Jouanguy et al. , 1999; Dorman and Holland, 2000). Functional evidence of gained

innate immunity was further supported by increased phagocytosis of neutrophils isolated from

practitioners (Fig. 4). The role of increased defensin and IFN and IFN-associated genes in

enhanced phagocytosis remains to be further determined; nonetheless, increased phagocytosis

suggests a functional correlation between gene regulation and cellular activity.

However, the immune response is like a double-edged sword and activation of the

immune system could be detrimental to the host when the immune response is sustained. How

can the immune cells from practitioners reconcile with the dilemma? Surprisingly, we have

identified another unexpected regulation, the apoptosis-related-genes, Bcl2, Bcl-xL, and

FKBP38, were significantly downregulated (Fig. 8). Bcl-2 and Bcl-xL are the anti-apoptotic

members of the Bcl-2 family (Adams and Cory, 2001; Zimmermann and Green, 2001), and a

decrease of those anti-apoptotic (cell death) genes may be responsible for the acceleration of

neutrophil apoptosis when stimulated with lipopolysaccharide (LPS) as shown in Figures 6 and

7. In addition, a decrease of FKBP38 may also favor neutrophil apoptosis, since FKBP38 is a

mitochondrial FK506-binding protein and may function to inhibit apoptosis by anchoring Bcl-2

and Bcl-x(L) to mitochondria (Shirane and Nakayama, 2003). In contrast to anti-apoptotic

genes, pro-apoptotic genes were conversely upregulated, including TNF receptor-1 associated

converting enzyme 2.

LPS is a proinflammatory agent and can stimulate cells to express multiple cytokines and

growth factors, which may be involved in the delay of apoptosis of proinflammatory cells as it is

- 15 -

In review (JACM)

well documented in literature (Smith, 1994). Delayed neutrophil apoptosis has been linked to a

variety of chronic inflammatory injuries (Webb et al. , 2000). The alteration of the apoptosisrelated

genes may be responsible for the accelerated apoptosis of LPS-stimulate apoptosis seen

in neutrophils from practitioners (Figs. 6 and 7). The accelerated neutrophil apoptosis may lead

to a rapid resolution of inflammation, resulting in limitation of self-injuries mediated by

enhanced immunity (Simpson and Hines, 2002; Matzinger, 2002; Medzhitov and Janeway,

2002). Survival of neutrophils from practitioners in the absence of LPS was significantly

prolonged and the prolonged neutrophil lifespan may also result from lowering of the

meditation-mediated metabolic rate since oxidative stress, instead of apoptotic genes, is the main

element responsible for spontaneous cell death of neutrophils in biological conditions (Akgul et

al. , 2001; Kasahara et al. , 1997). Our preliminary data has already shown that reactive

oxidative intermediates of neutrophils from FLG as well as from other meditation practitioners

were reduced. It was also demonstrated that lower serum lipid peroxide levels might be

associated with other meditation-mediated stress reduction (Schneider et al. , 1998).

The Yin-Yang theory may be used to explain the modern concept of immunology, such

as immune tolerance and immune activation. The balance between immune tolerance (Yin) and

activation (Yang) is a life-and-death issue (Simpson and Hines, 2002) (Fig. 8). Immune

tolerance and activation are opposed but interdependent. The immune system could be too

hypoactive (tolerant) to perform immune surveillance so that mutants and inflamed cells cannot

be removed, which may result from cancers and chronic inflammation, respectively. Immune

surveillance/ activation (Yang) should not be too strong to damage self either and immune

surveillance must be counteracted by self-limitation, e.g., inflammatory cells must be removed

by apoptotic death to resolve inflammation or stop the inflammation (Yang has a Yin aspect).

- 16 -

In review (JACM)

Immune tolerance is necessary to keep a living being in balance, but tolerance without

surveillance/activation may lead to cancers or autoimmune diseases, a typical manifestation of

interdependence of Yin and Yang. Mind/body interaction-mediated regulation can be expected

as a balance of Yin and Yang so that the shifty character of the immune system can be corrected,

e.g., immunity may be upregulated without adverse effects (Simpson and Hines, 2002).

Alteration of apoptotic genes of neutrophils from practitioners supported this notion (Fig.5), as

downregulation of anti-apoptotic genes in neutrophils favor rapid resolution of inflammatory

cells during inflammation, while prolonged survival of healthy neutrophils, which may result

from meditation-mediated reduction of oxidants, manifests efficient maintenance of immune

surveillance. While the immune system becomes hypo-metabolic (Yin) after meditation,

upregulation of host-defense (Yang) has been achieved to balance the enhanced Yin.

Therapeutically, if specific immune responses could be toned down without completely

suppressing immunity, it would provide a boon for the treatment of transplant rejection,

autoimmune disease, and allergy (Check, 2002). Yin-Yang balance-based immune regulation

may be an alternative to a variety of immune diseases.

We further confirmed some microarray data by RNase protection assay (RPA). Most of

the other changes in the genes could not be tested by this method due to the limited amount of

samples. The Ubiquitin gene was selected for confirmation by RPA due to its unique role in

protein metabolism. Both I-309 and defensin were chosen because they play an important role in

both innate and adaptive immunity. The anti-apoptotic gene, Bcl-x, was selected due to its

function in cell death. As shown in Fig. 9a, Ubiquitin was barely detected in all six practitioners

in contrast to six normal controls. The multiple bands seen below the main signal of ubiquitin

may result from partial protection of the ubiquitin probe by two other types of ubiquitin

- 17 -

In review (JACM)

transcripts. The ubiquitin probe that was used was generated from Ubiquitin C and shares great

homology with Ubiquitin A and Ubiquitin B. Defensin could also be detected in normal

controls, which is consistent with the findings by others, and both defensin and I-309 were

drastically elevated in practitioners as observed in the microarray assay as shown in Fig. 9b.

Little of I-309 was found in normal controls, although a weak signal was visible when the film

was exposed for a few days (data not shown). The probe set with multiple anti-apoptotic genes

was used to determine the expression level of Bcl-x. As shown in Fig. 9c, Bcl-x expression is

drastically reduced in practitioners, while the other anti-apoptotic genes, such as Bfl1, Bad1, and

Mcl1, are relatively unchanged. Specific downregulation of Bcl-x assayed by RPA not only has

further validated the microarray data, but also suggests the important role of this gene in

regulation of cellular apoptosis during inflammatory condictions. In addition, although

microarray data showed that Bcl-2 was markedly reduced in practitioners in contrast to controls,

Bcl-2 was not detectable in both controls and in practitioners by RNase protection assay. This

inconsistency may be due to the different sensitivity of microarray versus the RNase protection

assay.

Among 12,000 genes tested in the Affymetrix chip, about 200 genes were consistently

altered in six FLG practitioners with either increase or decrease in all of the practitioners and we

discussed some of the changed genes. However, most of the altered genes cannot be discussed

due to limited space, but we classified the rest of the altered genes into the following categories:

extracellular matrix and structural genes, the genes associated with DNA and RNA metabolism,

genes related to transcription and translation, genes involved in signal transduction, genes

associated with cell growth, cycling, function, and metabolism, and miscellaneous genes and

- 18 -

In review (JACM)

unclassified genes with unknown functions. This data is available upon request

(lfeng@bcm.tmc.edu)

A genomic view of changes in gene expression indicates a consistent reduction in

metabolic rate-related trends in the neutrophils isolated from practitioners. Downregulation of

the Ubiquitin system in the meditation practitioners may be explained by two reasons: 1)

substrate-dependent downregulation, since garbage disposal UPP was downregulated with

decreased metabolic wastes resulted from metabolic reduction; and 2) meditation-mediated

cellular activities directly leading to transcriptional arrest of UPP gene expression and

downregulation of UPP. Although there is no literature or study to support that downregulation

of the UPP system may be associated with a healthy phenotype in FLG practitioners, some

research with caloric restriction in rodent species as well as primates may shed some light on

such a possibility. Caloric restriction (CR) is the only known method to delay the aging process

and extend maximal lifespan in rodent species as well as in primates (Lane et al. , 2001; Roth

et al. , 2001). Such extension of lifespan is thought to involve metabolic reduction and

downregulation of UPP activity and was also associated with the phenotype of CR mice (Lee et

al. , 1999), supporting the notion that metabolic reduction might lead to shrinkage of this

“garbage disposal?accordingly. Moreover, it was also found that CR animals develop

significant stress- and disease-resistance (Raffoul et al. , 1999; Yu and Chung, 2001). A

dramatic decrease of the Ubiquitin protein degradation system in meditation practitioners

suggests that this system may function as a molecular sensor of metabolic conditions.

Interestingly, Ubiquitin was characterized as stress-inducible protein (Bond and Schlesinger,

1985; Bond and Schlesinger, 1986). Given the importance of the Ubiquitin proteasomemediated

protein degradation in various intracellular processes, in addition to the powerful

- 19 -

In review (JACM)

health-promoting and anti-aging benefits of FLG meditation, FLG meditation may serve as an

alternative therapeutic approach for various human diseases.

In conclusion, Qigong practice may affect expression levels of the genes involved in

protein synthesis, protein degradation, cellular metabolism, cell death, and immunity in

neutrophils. Among changes in profiling, apoptosis-related regulation is very novel: decrease of

anti-apoptotic genes in favor of a rapid resolution of inflammation while the immune system is

significantly enhanced simultaneously. This regulation is extremely important since it may

rectify the shifty character of the immune system by limiting self-damage resulting from

enhanced immunity. Downregulation of the metabolic trend seen in profiling, supports the

previous long-term hypothesis that lowering of metabolic rate may decrease the aging process

and further prolong lifespan. Significant changes of the UPP system may reflect the importance

of this system in the healthy phenotype of people practicing FLG meditation.

Because this is an observational pilot study, many questions cannot be addressed by this

report. Do all of FLG practitioners display the same genomic profiling? Does the length of time

practicing FLG correlate with changes in gene expression? Do other mind/body practitioners

have the similar changes in gene expression? What is the precise biological meaning of gene

regulation in neutrophils? Could our findings be clinically useful? Although the mechanism and

generalizability remain unclear, our pilot study provides the first evidence that Qigong practice

may exert on immunity, metabolic rate, and cell death possibly through transcriptional

regulation.

- 20 -

In review (JACM)

defensin may also contribute to the HIV resistance in practitioners. Recently, Zhang et al.

activity (Zhang et al. Contribution of human alpha-defensin 1, 2, and 3 to the anti-HIV-1 activity

of CD8 antiviral factor Science 2002 Nov 1; 298(5595): 995-1000)

- 21 -

In review (JACM)

We thank T. Wang from Virginia Mason Research Center for her useful suggestions; C.W.

Smith from Baylor College of Medicine and T. Wang for their critical review, encouragement,

and support; and C. Robinson and L. Schmidt for their secretarial assistance. This work was

supported by a grant to L. Feng from The Department fund of the Baylor College of Medicine.

- 22 -

In review (JACM)

Reproducibility is shown by microarray of samples prepared independently from an individual

(A and B). Similar intensities of the numbered probes are shown in the scanned images. The

intensities of numbered spots are listed in C.

All data points are on a 45¢X angle, confirming the accuracy of this technique. Scattered plot of a

practitioner versus control 1 and control 2 is shown in a and b, respectively. Scattered plot of a

control versus two practitioners (Practitioners 2 and 3) is shown in c and d. The similar pattern

is shown in a and b, respectively.

practitioners who have practiced FLG for at least one or more years (1-5) as described in

Materials and Methods. Positive values indicate an increase in gene expression and negative

values indicate a decrease. The solid bars represent the mean fold changes of six FLG

practitioners in contrast to a pooled sample from six normal controls and the fold changes from

each FLG practitioner are generated from three independent experiments. The error bars

represent the variation of six individuals for each gene.

3a. Downregulation of UPP-related genes

3b. Decrease of ribosomal genes.

3c. Alteration of stress-related and heat shock genes

3d. Regulation of immunity-associated genes

- 23 -

In review (JACM)

grown as described in Materials and Methods. Maximal neutrophil bactericidal activity was

measured by the decrease in the number of viable bacteria after incubation of bacteria with

neutrophils. The bactericidal activity was expressed as the percentage of killed bacteria. The

solid bars represent the mean of six FLG practitioners or six normal controls and the values from

each subject are generated based upon three independent experiments. Error bars represent

variation of six individuals in each experimental condition. As shown in the figure, the

bactericidal activity exerted by PMN was significantly increased in FLG groups in comparison

with normal controls and a statistical significance was found in all Effectors /Target (E/T) ratios

(p < 0.0001).

The bar graph represents genes that are regulated > 2-fold in neutrophils from six FLG

practitioners who have practiced FLG for at least one or more (1-5) as described in Materials and

Methods. Positive values indicate an increase in gene expression and negative values indicate a

decrease. The solid bars represent the mean fold changes of six FLG practitioners in contrast to

a polled sample from six normal controls and the fold changes from an individual are generated

from three independent experiments. The error bars represent variation of six individuals for

each gene.

Neutrophil apoptosis was significantly decreased in FLG practitioners as assessed by ELISA

described in Materials and Methods * Indicates a significant difference between the means of

- 24 -

In review (JACM)

Neutrophils were isolated and treated as described in Materials and Methods. Neutrophils were

cultured for 16 hrs in the absence (upper panel) and presence (lower panel) of LPS (25 ng/ml).

Wright-stained at different time points and examined by light microscopy and apoptotic cells are

red-circled. Arrows indicates shrunk neutrophils with chromatin condensation, rounded nuclear

profiles, and presence of cytoplasmic vacuolization. As shown in the figure, most of neutrophils

from a FLG practitioner were alive without apoptosis in the absence of LPS (a); however, most

of the neutrophils when stimulated with LPS were apoptotic (c). In contrast, neutrophils from a

normal control without LPS stimulation were apoptotic (b); however, neutrophils when

stimulated with LPS were alive (d).

Immune tolerance and immune activation are opposed but interdependent (a). Immune tolerance

can protect the host from self-damage, while immune surveillance/activation is responsible for

elimination of the damaged and mutant cells as well as protect the host from pathological

invaders. However, Ying must have a Yang aspect, since immune tolerance without immune

activation may lead to a host susceptible to cancers and infectious disease. Yang must have a

Yin aspect as well, since immune activation without self-limitation/inhibition (decrease of

- 25 -

In review (JACM)

based regulation in neutrophils from Qigong practitioners was illustrated. Pro-inflammatory

genes (anti-apoptotic genes) are decreased and inflammatory traits are limited (Yin) while

immune cells gain enhanced immunity (Yang) in neutrophils isolated from Qigong practitioners

(Yang has a Yin aspect). The enhanced immunity-associate changes represent a Yang aspect of

Yin to protect the host from microbial insults while cells are hypoactive (lower metabolism).

Neutrophils from practitioners are hypo-metabolic and less inflamed, but equipped with

immunity-enhanced molecules (Yin has a Yang aspect). The adverse effects that result from

upregulated immunity can be cancelled out by a rapid elimination of activated and inflamed cells

due to a lack of anti-apoptotic genes.

Human neutrophils were isolated and total RNA was extracted as described in Materials and

polylinker regions and longer than the protected bands. Multiple bands seen in RPA of

ubiquitin might result from partial protection of ubiquitin A and B with the probe generated with

polyubiquitin C, UBC (9a). The ubiquitin probe was subcloned from an EST clone, BM172182

(bp146-456), which is UBC and shares high homology with both ubiquitin A (AF348700) and B

(NM_018955). Both defensin (AW468629, bp1-300) and I-309 (M57502, bp1- 250) were

shown in Fig 9b; and anti-apoptotic genes (Cat: 556235, BD Pharmingen, San Diego CA) were

shown in Fig. 9c. The probes used for Fig 9c include Bclw, Bclx, Blf1, Bad, Bik, Bak, Bcl2, and

Mcl1.

.

- 26 -

In review (JACM)

Reprint requests should be sent to: Dr. Lili Feng, Department of Medicine, N520, Baylor College

- 27 -

In review (JACM)

Adams JM, Cory S. Life-or-death decisions by the Bcl-2 protein family. Trends Biochem Sci

2001;26(1):61-6.

Adams J. Proteasome inhibition in cancer: development of PS-341. Semin Oncol

2001;28(6):613-9.

Akgul C, Moulding DA, Edwards SW. Molecular control of neutrophil apoptosis. FEBS Lett

2001;487(3):318-22.

Bond U, Schlesinger MJ. Ubiquitin is a heat shock protein in chicken embryo fibroblasts. Mol

Cell Biol 1985;5(5):949-56.

Bond U, Schlesinger MJ. The chicken ubiquitin gene contains a heat shock promoter and

expresses an unstable mRNA in heat-shocked cells. Mol Cell Biol 1986;6(12):4602-10.

Cha KY, Wirth DP, Lobo RA. Does prayer influence the success of in vitro fertilization-embryo

transfer? Report of a masked, randomized trial. J Reprod Med 2001;46(9):781-7.

Chandler E. Spirituality. Hosp J 1999;14(3-4):63-74.

Check E. Immunology: The virtue of tolerance. Nature 2002;418(6896):364-6.

Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium

thiocyanate- phenol-chloroform extraction. Anal Biochem 1987;162(1):156-9.

Ciechanover A, Schwartz AL. Ubiquitin-mediated degradation of cellular proteins in health and

disease. Hepatology 2002;35(1):3-6.

Coffino P. Antizyme, a mediator of ubiquitin-independent proteasomal degradation. Biochimie

2001;83(3-4):319-23.

Coker KH. Meditation and prostate cancer: integrating a mind/body intervention with traditional

therapies. Semin Urol Oncol 1999;17(2):111-8.

Dennis C. Mouse genome: a forage in the junkyard. Nature 2002;420(6915):458-9.

Dorman SE, Holland SM. Interferon-gamma and interleukin-12 pathway defects and human

disease. Cytokine Growth Factor Rev 2000;11(4):321-33.

Emanuel EJ, Daniels ER, Fairclough DL, Clarridge BR. The practice of euthanasia and

physician-assisted suicide in the United States: adherence to proposed safeguards and effects

on physicians. Jama 1998;280(6):507-13.

- 28 -

In review (JACM)

Enard W, Khaitovich P, Klose J, Zollner S, Heissig F, Giavalisco P, et al. Intra- and interspecific

variation in primate gene expression patterns. Science 2002;296:340-343.

Fellermann K, Stange EF. Defensins -- innate immunity at the epithelial frontier. Eur J

Gastroenterol Hepatol 2001;13(7):771-6.

Feng L, Xia Y, Wilson CB. Alternative splicing of the NC1 domain of the human alpha 3(IV)

collagen gene. Differential expression of mRNA transcripts that predict three protein variants

with distinct carboxyl regions. J Biol Chem 1994;269(3):2342-8.

Finch JS, St John T, Krieg P, Bonham K, Smith HT, Fried VA, et al. Overexpression of three

ubiquitin genes in mouse epidermal tumors is associated with enhanced cellular proliferation

and stress. Cell Growth Differ 1992;3(5):269-78.

Garber K. Cancer research. Taking garbage in, tossing cancer out? Science 2002;295(5555):612-

3.

Garcia GE, Chen SC, Xia Y, Harrison JK, Johnson KJ, Bacon K, et al. Mononuclear cellinfiltrate

inhibition by blocking macrophage-derived chemokine results in attenuation of

developing crescentic glomerulonephritis. Am J Pathol 2003;In press.

Gimbel MA. Yoga, meditation, and imagery: clinical applications. Nurse Pract Forum

1998;9(4):243-55.

Glickman MH, Ciechanover A. The ubiquitin-proteasome proteolytic pathway: destruction for

the sake of construction. Physiol Rev 2002;82(2):373-428.

Hershko A, Ciechanover A. The ubiquitin system. Annu Rev Biochem 1998;67:425-79.

Horuk R, Hesselgesser J, Zhou Y, Faulds D, Halks-Miller M, Harvey S, et al. The CC

chemokine I-309 inhibits CCR8-dependent infection by diverse HIV-1 strains. J Biol Chem

1998;273(1):386-91.

Jackson PK, Eldridge AG, Freed E, Furstenthal L, Hsu JY, Kaiser BK, et al. The lore of the

RINGs: substrate recognition and catalysis by ubiquitin ligases. Trends Cell Biol

2000;10(10):429-39.

Joazeiro CA, Weissman AM. RING finger proteins: mediators of ubiquitin ligase activity. Cell

2000;102(5):549-52.

Jones BM. Changes in cytokine production in healthy subjects practicing Guolin Qigong : a pilot

study. BMC Complement Altern Med 2001;1(1):8.

Jouanguy E, Doffinger R, Dupuis S, Pallier A, Altare F, Casanova JL. IL-12 and IFN-gamma in

host defense against mycobacteria and salmonella in mice and men. Curr Opin Immunol

1999;11(3):346-51.

- 29 -

In review (JACM)

Kaba A, Jiang PH, Chany-Fournier F, Chany C. Sarcolectin (SCL): structure and expression of

the recombinant molecule. Biochimie 1999;81(7):709-15.

Kaiser V, Diamond G. Expression of mammalian defensin genes. J Leukoc Biol 2000;68(6):779-

84.

Kasahara Y, Iwai K, Yachie A, Ohta K, Konno A, Seki H, et al. Involvement of reactive oxygen

intermediates in spontaneous and CD95 (Fas/APO-1)-mediated apoptosis of neutrophils. Blood

1997;89(5):1748-53.

Kiecolt-Glaser JK, McGuire L, Robles TF, Glaser R. EMOTIONS, MORBIDITY, AND

MORTALITY: New Perspectives from Psychoneuroimmunology. Annu Rev Psychol

2002;53:83-107.

King MC, Wilson AC. Evolution at two levels in humans and chimpanzees. Science

1975;188(4184):107-16.

Krucoff MW, Crater SW, Green CL, Maas AC, Seskevich JE, Lane JD, et al. Integrative noetic

therapies as adjuncts to percutaneous intervention during unstable coronary syndromes:

Monitoring and Actualization of Noetic Training (MANTRA) feasibility pilot. Am Heart J

2001;142(5):760-9.

Lane MA, Black A, Handy A, Tilmont EM, Ingram DK, Roth GS. Caloric restriction in

primates. Ann N Y Acad Sci 2001;928:287-95.

Latchman DS. Heat shock proteins and cardiac protection. Cardiovasc Res 2001;51(4):637-46.

Lee CK, Klopp RG, Weindruch R, Prolla TA. Gene expression profile of aging and its

retardation by caloric restriction. Science 1999;285(5432):1390-3.

Lee S, Tiffany HL, King L, Murphy PM, Golding H, Zaitseva MB. CCR8 on human thymocytes

functions as a human immunodeficiency virus type 1 coreceptor. J Virol 2000;74(15):6946-52.

Li HZ. Zhuan Falun The complete teaching of Falun Gong. Gloucester, Massachusetts: Fair

Winds Press; 1994.

Li Q, Xia Y, Garcia GE, Chen Q, Li P, Romo GM, et al. Genome-wide profiles of gene

expression in neutrophils from Falun Gong practitioners and normal healthy controls. First

World Congress of Future Science and Culture 2002.

Maguire BA, Zimmermann RA. The ribosome in focus. Cell 2001;104(6):813-6.

Matzinger P. The Danger Model: A Renewed Sense of Self. Science 2002;296(5566):301-305.

- 30 -

In review (JACM)

Medzhitov R, Janeway CA, Jr. Decoding the patterns of self and nonself by the innate immune

system. Science 2002;296(5566):298-300.

Nenoi M. Induced accumulation of polyubiquitin gene transcripts in HeLa cells after UVirradiation

and TPA-treatment. Int J Radiat Biol 1992;61(2):205-11.

Paabo S. Genomics and society. The human genome and our view of ourselves. Science

2001;291(5507):1219-20.

Pettinati PM. Meditation, yoga, and guided imagery. Nurs Clin North Am 2001;36(1):47-56.

Post SG, Puchalski CM, Larson DB. Physicians and patient spirituality: professional boundaries,

competency, and ethics. Ann Intern Med 2000;132(7):578-83.

Raffoul JJ, Guo Z, Soofi A, Heydari AR. Caloric restriction and genomic stability. J Nutr Health

Aging 1999;3(2):102-10.

Reymond A, Meroni G, Fantozzi A, Merla G, Cairo S, Luzi L, et al. The tripartite motif family

identifies cell compartments. Embo J 2001;20(9):2140-51.

Roth GS, Ingram DK, Lane MA. Caloric restriction in primates and relevance to humans. Ann N

Y Acad Sci 2001;928:305-15.

Samuel CE. Antiviral actions of interferons. Clin Microbiol Rev 2001;14(4):778-809.

Schneider RH, Nidich SI, Salerno JW, Sharma HM, Robinson CE, Nidich RJ, et al. Lower lipid

peroxide levels in practitioners of the Transcendental Meditation program. Psychosom Med

1998;60(1):38-41.

Shang C. Emerging paradigms in mind-body medicine. J Altern Complement Med 2001;7(1):83-

91.

Shirane M, Nakayama KI. Inherent calcineurin inhibitor FKBP38 targets Bcl-2 to mitochondria

and inhibits apoptosis. Nat Cell Biol 2003;5(1):28-37.

Shtrichman R, Samuel CE. The role of gamma interferon in antimicrobial immunity. Curr Opin

Microbiol 2001;4(3):251-9.

Simpson SJ, Hines PJ. Self-Discrimination, a Life and Death Issue. Science

2002;296(5566):297-.

Smith JA. Neutrophils, host defense, and inflammation: a double-edged sword. J Leukoc Biol

1994;56(6):672-86.

Sonneborn JS, Barbee SA. Exercise-induced stress response as an adaptive tolerance strategy.

Environ Health Perspect 1998;106(Suppl 1):325-30.

- 31 -

In review (JACM)

Sovik R. The science of breathing--the yogic view. Prog Brain Res 2000;122:491-505.

Symington LS. Role of RAD52 epistasis group genes in homologous recombination and doublestrand

break repair. Microbiol Mol Biol Rev 2002;66(4):630-70, table of contents.

Tuteja N, Tuteja R. Unraveling DNA repair in human: molecular mechanisms and consequences

of repair defect. Crit Rev Biochem Mol Biol 2001;36(3):261-90.

van Wetering S, Sterk PJ, Rabe KF, Hiemstra PS. Defensins: key players or bystanders in

infection, injury, and repair in the lung? J Allergy Clin Immunol 1999;104(6):1131-8.

Vu PK, Sakamoto KM. Ubiquitin-mediated proteolysis and human disease. Mol Genet Metab

2000;71(1-2):261-6.

Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, Agarwal P, et al. Initial

sequencing and comparative analysis of the mouse genome. Nature 2002;420(6915):520-62.

Webb PR, Wang KQ, Scheel-Toellner D, Pongracz J, Salmon M, Lord JM. Regulation of

neutrophil apoptosis: a role for protein kinase C and phosphatidylinositol-3-kinase. Apoptosis

2000;5(5):451-8.

Xia Y, Chen S, Wang Y, Mackman N, Ku G, Lo D, et al. RelB modulation of IkappaBalpha

stability as a mechanism of transcription suppression of interleukin-1alpha (IL-1alpha), IL-

1beta, and tumor necrosis factor alpha in fibroblasts. Mol Cell Biol 1999;19(11):7688-96.

Yewdell JW. Not such a dismal science: the economics of protein synthesis, folding, degradation

and antigen processing. Trends Cell Biol 2001;11(7):294-7.

Yu BP, Chung HY. Stress resistance by caloric restriction for longevity. Ann N Y Acad Sci

2001;928:39-47.

Zimmermann KC, Green DR. How cells die: apoptosis pathways. J Allergy Clin Immunol

2001;108(4 Suppl):S99-103.

- 32 -